Skip to main content

Table 1 Sequences and optimized concentration of primers used in this study

From: Algae-meditated route to cuprous oxide (Cu2O) nanoparticle: differential expression profile of MALAT1 and GAS5 LncRNAs and cytotoxic effect in human breast cancer

Primers Primer Sequences (5′ to 3′) Primer concentrations (nM) Annealing temperature (°C) Product size (bp)
GAPDH AATGGGCAGCCGTTAGGAAA 300 55 168
GCGCCCAATACGACCAAATC 300
p27 TGGAGAAGCACTGCAGAGAC 300 53 252
GCGTGTCCTCAGAGTTAGCC 600
p53 TACTCCCCTGCCCTCAACAAGA 300 55 181
CGCTATCTGAGCAGCGCTCATG 300
bax TCTGACGGCAACTTCAACTG 600 56 188
TTGAGGAGTCTCACCCAACC 900
Bcl2 GGATGCCTTTGTGGAACTGT 300 63 236
AGCCTGCAGCTTTGTTTCAT 600
Caspase 3 CGGGGTACGGAGCTGGACTGT 300 58 251
AATTCCGTTGCCACCTTCCTGTT 300
GAS5 TGAAGTCCTAAAGAGCAAGCC 900 52 120
ACCAGGAGCAGAACCATTAAG 300
MALAT1 ATGCGAGTTGTTCTCCGTCT 300 52 118
TATCTGCGGTTTCCTCAAGC 300