Skip to main content

Table 3 Primers used to evaluate the expression of genes involved in proliferation and cell adhesion

From: Graphene oxide nanofilm and chicken embryo extract decrease the invasiveness of HepG2 liver cancer cells

Gene Sequence of primer 5′→3′ Amplicon size (bp) GenBank accession number References
pcna F: CCATCCTCAAGAAGGTGTTGG
R: GTGTCCCATATCCGCAATTTTAT
710 NM_182649.2 PrimerBlast
ki67 F: CCACACTGTGTCGTCGTTTG
R: CCGTGCGCTTATCCATTCA
123 NM_001145966.2 Szczepaniak et al. (2018)
mcm2 F: GTGGATAAGGCTCGTCAGAT
R: GTCGTGGCTGAACTTGTT
87 NM_004526.4 Szczepaniak et al. (2018)
α1 F: GGTTCCTACTTTGGCAGTATT
R: AACCTTGTCTGATTGAGAGCA
149 NM_181501.2 Dingemans et al. (2010)
α2 F: GGAACGGGACTTTCGCAT
R: GGTACTTCGGCTTTCTCATCA
154 NM_002203.4 Dingemans et al. (2010)
α3 F: AAGGGACCTTCAGGTGCA
R: TGTAGCCGGTGATTTACCAT
129 NM_002204.4 Dingemans et al. (2010)
α4 F: GCTTCTCAGATCTGCTCGTG
R: GTCACTTCCAACGAGGTTTG
131 NM_000885.6 Dingemans et al. (2010)
α5 F: TGCAGTGTGAGGCTGTGTACA
R: GTGGCCACCTGACGCTCT
88 NM_002205.5 Dingemans et al. (2010)
α6 F: TTGAATATACTGCTAACCCCG
R: TCGAAACTGAACTCTTGAGGATAG
113 NM_000210.4 Dingemans et al. (2010)
αV F: AATCTTCCAATTGAGGATATCAC
R: AAAACAGCCAGTAGCAACAAT
140 NM_001145000.3 Dingemans et al. (2010)
β1 F: GAAGGGTTGCCCTCCAGA
R: GCTTGAGCTTCTCTGCTGTT
107 NM_002211.4 Dingemans et al. (2010)
β4 F: AGACGAGATGTTCAGGGACC
R: GGTCTCCTCTGTGATTTGGAA
115 NM_001321123.2 Dingemans et al. (2010)
Fak F: CCCACCAGAGGAGTATGTCC
R: CCCAGGTCAGAGTTCAATAG
150 XM_017013688.2 Chen et al. (2012)
e-cadherin F: ACAACGCCCCCATACCAGA
R: CACTCGCCCCGTGTGTTAGT
138 NM_001317185.2 PrimerBlast
n-cadherin F: ACAGATGTGGACAGGATTGTGGGT
R: TATCCCGGCGTTTCATCCATACCA
124 NM_001308176.2 PrimerBlast
β-catenin F: CCTATGCAGGGGTGGTCAAC
R: CGACCTGGAAAACGCCATCA
95 NM_001012329.2 PrimerBlast
gapdh F: GAGAAGGCTGGGGCTCATTTG
R: CATGGTTCACACCCATG
97 NM_002046 PrimerBlast